Микробиота пародонтальных карманов у пациентов с сахарным диабетом 2 типа


Конструирование олигонуклеотидных праймеров



страница21/33
Дата03.03.2020
Размер1.54 Mb.
1   ...   17   18   19   20   21   22   23   24   ...   33
2.4.3. Конструирование олигонуклеотидных праймеров

Конструирование, анализ олигонуклеотидных праймеров и определение температуры плавления праймеров осуществляли с помощью компьютерных программ Primer 3 и OLIGO 4.0 (табл. 2.4.3.1).



Таблица 2.4.3.1

Олигонуклеотидные праймеры






Название

5’→3’

Т0отж.

Размер фрагмента, п.н.




P. gingivalis

1

Gin1

GTATATGCTCGACGAGGTGGAA

57,0

334

2

Gin2

ATTGTCCAGGGTAACTTCTTCG










T. forsythia

3

For1

CGAGGGTTCAATACGCTGTT

54,0

572

4

For2

ATAAAAATCGCATCGCAAGG










P. intermedia

5

Int1

AATACAGCCTTCGAGGGTTT

55,0

335

6

Int2

TTCGGTCAAGACAGTAGGGA










T. denticola

7

Den1

TAATACCGAATGTGCTCATTTACAT

60,0

311

8

Den2

TCAAAGAAGCATTCCCTCTTCTTCTTA







2.4.4. Полимеразная цепная реакция (ПЦР)

Полимеразная цепная реакция (ПЦР) – это метод ферментативного получения амплификаций (большого количества копий) исследуемых фрагментов ДНК путем повторных циклов репликации и денатурации (разделения цепи ДНК на отдельные нити). При этом происходит копирование только исследуемого участка ДНК, поскольку только этот участок соответствует заданным условиям и только в том случае, если он присутствует в исследуемом образце.

К 0,25 мкл геномной ДНК добавляли 10 мкмолей каждого из специфических праймеров, фланкирующих исследуемую последовательность, буфер с магнием для полимеразы, по 0,2 мМ каждого из 4 дезоксирибонуклеотидтрифосфатов, объем доводили водой до 25 мкл. Добавляли 0,4 мкл термостабильной ДНК полимеразы. На поверхность жидкости наслаивали 40 мкл минерального масла. Пробирки помещали в амплификатор (Терцик, Россия). Смесь инкубировали при t = 94оС в течение 3 минут. Прибор программировали по активному регулированию температуры в растворе: цикл денатурации t = 94oС на 15 секунд, цикл отжига праймеров на 15 секунд, цикл синтеза ДНК t = 72oС на 20 секунд. Последовательность таких циклов повторялась 35 раз. После чего смесь инкубировали при t = 72oС в течение 5 минут. Олигонуклеотидные праймеры, использованные в работе, приведены в таблице 2.4.3.1.

2.4.5. Электрофорез фрагментов ДНК

Электрофорез ДНК проводили в 1,0% агарозном геле в горизонтальном аппарате «WideMini-SubCell GT Cell- 170-4468» (BioRad, США) с использованием ТАЕ буфера (ThermoScientific, Германия). Время электрофореза – 40 мин, напряжение устанавливали 120 В при площади геля 150 см2. Для визуализации ДНК в ультрафиолетовых лучах в гель добавляли раствор бромистого этидия (0,5 мкг/мл). Визуализацию результатов электрофореза проводили в ультрафиолетовом свете с использованием системы видеозахвата «VersaDoc MP 4000» (BioRad, США) и системы видеозахвата, использующей цифровой фотоаппарат (Olimpus, Япония) и компьютерную программу «QuantityOne» (США).

Для расчета молекулярных масс исследуемых фрагментов ДНК использовали ДНК-маркер «100 bpPlus DNA ladder».

2.5. Компьютерный анализ

Статистическая обработка включала вычисление параметров средних величин, значение среднего квадратического отклонения, значение средней ошибки среднего арифметического числа. Был произведен расчет достоверности разности средних величин, а также корреляционный анализ в программе Microsoft Excel. Для визуализации результатов исследования были построены диаграммы.


Каталог: bitstream -> 11701
11701 -> Учебное пособие Санкт-Петербург 2016 (075. 8)
11701 -> Особенности течения ишемической болезни сердца у пациентов, получающих терапию гемодиализом
11701 -> Эффективность лечения бесплодия методами экстракорпорального оплодотворения у женщин с миомой матки
11701 -> Высшего образования
11701 -> Влияние антидепрессивной терапии на когнитивные функции больных депрессией
11701 -> «Клинико-функциональная характеристика ремиссии у больных с первым эпизодом шизофрении»
11701 -> Психосоматические проявления при экстремальных спортивных нагрузках по специальности 030302 Клиническая психология
11701 -> Функции воздействия в тексте медицинской рекламы
11701 -> Анилиз случаев системных заболеваний
11701 -> Высшего образования


Поделитесь с Вашими друзьями:
1   ...   17   18   19   20   21   22   23   24   ...   33




База данных защищена авторским правом ©zodorov.ru 2020
обратиться к администрации

    Главная страница